Summary Information for BC10522 | |
Gene(s) | C17G10.2 |
---|---|
Locus | |
Strain | BC10522 |
Transgene | sEx10522 |
Mutagen | |
Primer A | tctccgactcgaggaactgt |
Primer B | ctggggaagatcgattggt |
Location (WS140) | II:5591749..5594719 [Wormbase - current] |
Comments | Embryo incomplete. To be updated. |
Expression Pattern | |
pharynx, body wall muscle, head neurons | |
pharynx, vulval muscle, body wall muscle, ventral nerve cord, head neurons | |
Embryo GFP | No |
Embryo Rec. | No |