Summary Information for BC10570 | |
| Gene(s) | C03G5.1 |
|---|---|
| Locus | |
| Strain | BC10570 |
| Transgene | sEx10570 |
| Mutagen | |
| Primer A | ttcaggctatccaatggtttct |
| Primer B | cggctcggaggatttttc |
| Location (WS140) | X:8545940..8546604 [Wormbase - current] |
| Comments | Adult and larval have expression in either the seam cells or H cell but it was difficult to determine. There is also occassional mosaic expression in the body wall muscle. |
| Expression Pattern | |
| yes | |
| pharynx, intestinal, body wall muscle, head neurons, tail neurons, unidentified cells | |
| pharynx, intestinal, body wall muscle, head neurons, body neurons, tail neurons | |
| Embryo GFP | Yes |
| Embryo Rec. | No |