Summary Information for BC11480 | |
Gene(s) | F55C7.7B |
---|---|
Locus | unc-73 |
Strain | BC11480 |
Transgene | sEx11480 |
Mutagen | |
Primer A | gacaccgatatggtttttgacat |
Primer B | atggaggaattttatgcgaattt |
Location (WS140) | I:4031634..4034495 [Wormbase - current] |
Comments | Embryo incomplete. To be updated. Adults occassionally have same GFP pattern as larvae. |
Expression Pattern | |
nerve ring, ventral nerve cord, head neurons, tail neurons | |
pharynx, intestinal, unidentified cells | |
Embryo GFP | No |
Embryo Rec. | No |