Summary Information for BC11600 | |||
| Gene(s) | E03G2.3 | ||
|---|---|---|---|
| Locus | mec-5 | ||
| Strain | BC11600 | ||
| Transgene | sEx11600 | ||
| Mutagen | |||
| Primer A | tgggttcaaagaacaatttaagg | ||
| Primer B | tcatgaaaagctgttgaaaacaa | ||
| Location (WS140) | X:15941054..15943904 [Wormbase - current] | ||
| Comments | Embryo incomplete. To be updated. | ||
| Expression Pattern | |||
| ventral nerve cord, unidentified head, unidentified tail | |||
| ventral nerve cord, dorsal nerve cord, unidentified head, unidentified tail | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
