Summary Information for BC11834 | |
Gene(s) | M176.2 |
---|---|
Locus | |
Strain | BC11834 |
Transgene | sEx11834 |
Mutagen | |
Primer A | taggaaggaacaagtgtttgtttg |
Primer B | gagcgattcttgaaaaattacga |
Location (WS140) | II:9416336..9419244 [Wormbase - current] |
Comments | An unidentified bright cell in the head. Embryo incomplete. To be updated. |
Expression Pattern | |
pharynx, intestinal, unidentified head | |
pharynx, intestinal, unidentified head | |
Embryo GFP | No |
Embryo Rec. | No |