Summary Information for BC12239 | |||||||||
Gene(s) | D1081.2 | ||||||||
---|---|---|---|---|---|---|---|---|---|
Locus | unc-120 | ||||||||
Strain | BC12239 | ||||||||
Transgene | sEx12239 | ||||||||
Mutagen | |||||||||
Primer A | tttgtaatagagccccgtgc | ||||||||
Primer B | tcggtgatgttctgaaattttg | ||||||||
Location (WS140) | I:8465496..8468360 [Wormbase - current] | ||||||||
Comments | Embryo incomplete. To be updated. | ||||||||
Expression Pattern | |||||||||
intestinal muscle, anal depressor muscle, body wall muscle | |||||||||
intestinal muscle, anal depressor muscle, body wall muscle | |||||||||
Embryo GFP | No | ||||||||
Embryo Rec. | No | ||||||||
Video(s) | |||||||||
|