Summary Information for BC12364 | |
Gene(s) | C05D11.12 |
---|---|
Locus | let-721 |
Strain | BC12364 |
Transgene | sIs10569 |
Mutagen | 1500 R x-rays |
Primer A | tcctttgttttgtttgtgttcc |
Primer B | tgaagtcacagaaattgagaaatga |
Location (WS140) | III:6446846..6448186 [Wormbase - current] |
Comments | Embryo incomplete. To be updated. |
Expression Pattern | |
pharynx, intestinal, body wall muscle, unidentified cells | |
pharynx, intestinal, body wall muscle, unidentified cells | |
Embryo GFP | No |
Embryo Rec. | No |