|
| Gene(s) | C07H6.3 |
|---|
| Locus | |
|---|
| Strain | BC12754 |
|---|
| Transgene | sIs12567 |
|---|
| Mutagen | 1500 R x-rays |
|---|
| Primer A | attggaattgagttggcactct |
|---|
| Primer B | gttggtgtcgatcaggtgg |
|---|
| Location (WS140) | III:7505281..7508126 [Wormbase - current] |
|---|
| Comments | Pharynx expression is the MARGINAL CELLS (Hall Lab, 2005).unidentified cells in tail and head head is possibly neural!! low intensity GFP. |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, pharyngeal-intestinal valve, rectal gland cells, uterine-seam cell, unidentified head, unidentified tail |
| Adult | pharynx, pharyngeal-intestinal valve, rectal gland cells, uterine-seam cell, uterus, vulva other, spermatheca, nerve ring, ventral nerve cord, unidentified head, unidentified tail |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
| Video(s) |
|
|---|
|
