|
| Gene(s) | F47F6.2 |
|---|
| Locus | lin-42 |
|---|
| Strain | BC13765 |
|---|
| Transgene | sEx13765 |
|---|
| Mutagen | |
|---|
| Primer A | tctaaccggtcactctgtactctg |
|---|
| Primer B | ctcgatttggctgatggtg |
|---|
| Location (WS140) | II:1244016..1246997 [Wormbase - current] |
|---|
| Comments | Notes were not entered into database, and images are only for larval/adult. Have extrapolated data from the images!! but this leaves the analysis incomplete.GFP in the head may be arcade cells!! hard to tell from image. |
|---|
| Expression Pattern |
|
|---|
| Larval | seam cells |
| Adult | pharynx, seam cells, unidentified head |
| Embryo GFP | No |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
