Summary Information for BC14222 | |||
Gene(s) | F33H2.3 | ||
---|---|---|---|
Locus | |||
Strain | BC14222 | ||
Transgene | sEx14222 | ||
Mutagen | |||
Primer A | cacataatcgatagactcccagc | ||
Primer B | tagacgggatgattgaggatg | ||
Location (WS140) | I:15039817..15042659 [Wormbase - current] | ||
Comments | Mosaic population. Hypodermis: only in the tail. Coelomocytes: saw the 4 ventral cells. | ||
Expression Pattern | |||
yes | |||
pharynx, pharyngeal-intestinal valve, intestinal muscle, anal depressor muscle, anal sphincter, rectal epithelium, distal tip cell, developing gonad, developing vulva, developing uterus, uterine-seam cell, developing spermatheca, gonad sheath cells, body wall muscle, hypodermis, excretory gland cells, coelomocytes, nerve ring, ventral nerve cord, dorsal nerve cord, lateral nerve cords/commissures, head neurons, body neurons | |||
pharynx, intestinal muscle, anal depressor muscle, uterine muscle, vulval muscle, spermatheca, body wall muscle, excretory gland cells, coelomocytes, nerve ring, ventral nerve cord, dorsal nerve cord, lateral nerve cords/commissures, head neurons, body neurons | |||
Embryo GFP | Yes | ||
Embryo Rec. | No | ||
Image(s) | |||