R90.3 Information
Source DNA C. elegans CHROMOSOME V
Coordinates 12906901..12907663
Length 762 bp
Strand -
Upstream gene R90.4, 1111 kb upstream, - strand
Other
  • Nested internal primers are paired with the external reverse primer
  • R90.3 is on the - strand; note that forward primers are oriented on the - strand; reverse primers are oriented on the + strand
  • Primers not allowed in upstream genes on the same strand
  • PCR product size reduced to 1011 +/- 100 to avoid nearby genes
  • e-PCR check: NOT REQUESTED
  • Tandem repeats excluded

  • Show text-only output      Back to Primer Design
    PCR Primers
    Set 1 Primer Sequence Tm Coordinate Primer Pair Quality
    External Forward attattgactttttcagccgc 58 12908687  
      Reverse tcctttgtagcaattggatcg 60 12907683 1.6832
    Expected Product Size: 1005 bp
    Nested 1 Forward ctatgcggcaaccaaaagtt 60 12908563  
      Reverse 1.2123
    Expected Product Size: 881 bp
    The reverse (B) primer is 19 bp. upstream of the ATG start.