Summary Information for BC10240 | |
Gene(s) | Y113G7B.17 |
---|---|
Locus | |
Strain | BC10240 |
Transgene | sEx10240 |
Mutagen | |
Primer A | ggcaagtcgtctgacatgatt |
Primer B | cccgctggaaaaaggttaat |
Location (WS140) | V:20267759..20268184 [Wormbase - current] |
Comments | Mosaic population. Embryo incomplete. To be updated. Strain not available. |
Expression Pattern | |
pharynx, intestinal, unidentified head | |
pharynx, anal depressor muscle, unidentified head | |
Embryo GFP | No |
Embryo Rec. | No |