Summary Information for BC10249 | |
| Gene(s) | K06H7.4 |
|---|---|
| Locus | grp-1 |
| Strain | BC10249 |
| Transgene | sEx10249 |
| Mutagen | |
| Primer A | gattagggctgtgcagcaa |
| Primer B | tgaataccgcgatgagattt |
| Location (WS140) | III:8084941..8085689 [Wormbase - current] |
| Comments | Very low intensity GFP. Embryo incomplete. To be updated. |
| Expression Pattern | |
| intestinal, rectal gland cells, head neurons, unidentified cells | |
| intestinal, head neurons, unidentified cells | |
| Embryo GFP | No |
| Embryo Rec. | No |