|
| Gene(s) | C03C10.1 |
|---|
| Locus | |
|---|
| Strain | BC10439 |
|---|
| Transgene | sEx10439 |
|---|
| Mutagen | |
|---|
| Primer A | tgaagttttcgtgaatcctcct |
|---|
| Primer B | attgtttgctctgatcgtgct |
|---|
| Location (WS140) | III:4086459..4089385 [Wormbase - current] |
|---|
| Comments | High intensity GFP, therefore hard to distinguish some tissues... there might be excretory cell expression; the neural analysis carries some uncertainty. |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, intestinal, anal depressor muscle, body wall muscle, hypodermis, nerve ring, ventral nerve cord, head neurons, tail neurons, unidentified cells |
| Adult | pharynx, intestinal, anal depressor muscle, vulval muscle, spermatheca, body wall muscle, hypodermis, nerve ring, ventral nerve cord, head neurons, tail neurons, unidentified cells |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
| Video(s) |
|
|---|
|
