Summary Information for BC10449 | |
| Gene(s) | B0547.1 |
|---|---|
| Locus | csn-5 |
| Strain | BC10449 |
| Transgene | sEx10449 |
| Mutagen | |
| Primer A | ctgcctttaagacccaaaagaat |
| Primer B | atcaacttcgatcgtctgaaaaa |
| Location (WS140) | IV:5646597..5649532 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, body wall muscle, unidentified tail | |
| pharynx, intestinal, vulval muscle, spermatheca, body wall muscle, unidentified tail | |
| Embryo GFP | No |
| Embryo Rec. | No |