Summary Information for BC10545 | |||
Gene(s) | F59A6.1 | ||
---|---|---|---|
Locus | nsy-1 | ||
Strain | BC10545 | ||
Transgene | sEx10545 | ||
Mutagen | |||
Primer A | gccctcaccgacagtttaag | ||
Primer B | ctgcgagattttcttttgattctt | ||
Location (WS140) | II:5019912..5022905 [Wormbase - current] | ||
Comments | Notes were not entered into database, and images are only for adult. Have extrapolated data from the images!! but this leaves the analysis incomplete. Unidentified head/tail GFP may be neural. | ||
Expression Pattern | |||
intestinal, hypodermis, unidentified head, unidentified tail | |||
Embryo GFP | No | ||
Embryo Rec. | No | ||
Image(s) | |||