Summary Information for BC10545 | |||
| Gene(s) | F59A6.1 | ||
|---|---|---|---|
| Locus | nsy-1 | ||
| Strain | BC10545 | ||
| Transgene | sEx10545 | ||
| Mutagen | |||
| Primer A | gccctcaccgacagtttaag | ||
| Primer B | ctgcgagattttcttttgattctt | ||
| Location (WS140) | II:5019912..5022905 [Wormbase - current] | ||
| Comments | Notes were not entered into database, and images are only for adult. Have extrapolated data from the images!! but this leaves the analysis incomplete. Unidentified head/tail GFP may be neural. | ||
| Expression Pattern | |||
| intestinal, hypodermis, unidentified head, unidentified tail | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
