Summary Information for BC10561 | |
| Gene(s) | F56H1.4 |
|---|---|
| Locus | rpt-5 |
| Strain | BC10561 |
| Transgene | sEx10561 |
| Mutagen | |
| Primer A | tcatgttgcacctttttattcg |
| Primer B | tgtttgcgagattgtactgctt |
| Location (WS140) | I:5751679..5754541 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, intestinal muscle, anal depressor muscle, developing gonad, body wall muscle, nerve ring, unidentified head, unidentified tail | |
| intestinal, spermatheca, gonad sheath cells, body wall muscle, unidentified head, unidentified tail | |
| Embryo GFP | No |
| Embryo Rec. | No |