Summary Information for BC10571 | |
| Gene(s) | T26A5.9 |
|---|---|
| Locus | dlc-1 |
| Strain | BC10571 |
| Transgene | sEx10571 |
| Mutagen | |
| Primer A | cactttgtgatcgtcggattta |
| Primer B | attttgaacggatttggctg |
| Location (WS140) | III:6463700..6466574 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, body wall muscle, ventral nerve cord, head neurons, tail neurons | |
| pharynx, intestinal, ventral nerve cord, head neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |