Summary Information for BC10597 | |
| Gene(s) | F35A5.8a |
|---|---|
| Locus | erp-1 |
| Strain | BC10597 |
| Transgene | sEx10597 |
| Mutagen | |
| Primer A | tcaatggttgtagcgtatttgc |
| Primer B | tcgatactgagttttcaacaatct |
| Location (WS140) | X:3802732..3805586 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, body wall muscle, ventral nerve cord, head neurons, tail neurons | |
| pharynx, vulval muscle, body wall muscle, head neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |