Summary Information for BC10615 | |||
| Gene(s) | T01C8.1a | ||
|---|---|---|---|
| Locus | |||
| Strain | BC10615 | ||
| Transgene | sEx10615 | ||
| Mutagen | |||
| Primer A | catcgacattcgagaggatttac | ||
| Primer B | gaaaagatttctgaaaatagtcgg | ||
| Location (WS140) | X:16793188..16796009 [Wormbase - current] | ||
| Comments | Neural in the tail is possibly the phasmid sheath cells. | ||
| Expression Pattern | |||
| yes | |||
| pharynx, excretory cell, head neurons, tail neurons | |||
| pharynx, excretory cell, head neurons, tail neurons | |||
| Embryo GFP | Yes | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
