Summary Information for BC10615 | |||
Gene(s) | T01C8.1a | ||
---|---|---|---|
Locus | |||
Strain | BC10615 | ||
Transgene | sEx10615 | ||
Mutagen | |||
Primer A | catcgacattcgagaggatttac | ||
Primer B | gaaaagatttctgaaaatagtcgg | ||
Location (WS140) | X:16793188..16796009 [Wormbase - current] | ||
Comments | Neural in the tail is possibly the phasmid sheath cells. | ||
Expression Pattern | |||
yes | |||
pharynx, excretory cell, head neurons, tail neurons | |||
pharynx, excretory cell, head neurons, tail neurons | |||
Embryo GFP | Yes | ||
Embryo Rec. | No | ||
Image(s) | |||
|