|
| Gene(s) | B0336.3 |
|---|
| Locus | |
|---|
| Strain | BC10655 |
|---|
| Transgene | sEx10655 |
|---|
| Mutagen | |
|---|
| Primer A | atatcaatgaaaacggtcaatgg |
|---|
| Primer B | attgtcgatgtggatgctttc |
|---|
| Location (WS140) | III:5708646..5711549 [Wormbase - current] |
|---|
| Comments | Neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see. |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, pharyngeal gland cells, intestinal, intestinal muscle, anal depressor muscle, anal sphincter, body wall muscle, hypodermis, seam cells, nerve ring, head neurons, labial sensilla, tail neurons, unidentified tail |
| Adult | pharynx, pharyngeal gland cells, intestinal, intestinal muscle, anal depressor muscle, anal sphincter, uterine-seam cell, body wall muscle, hypodermis, seam cells, nerve ring, head neurons, labial sensilla, tail neurons, unidentified tail |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
