|
| Gene(s) | F55A12.8 |
|---|
| Locus | |
|---|
| Strain | BC10680 |
|---|
| Transgene | sIs10083 |
|---|
| Mutagen | 1500 R x-rays |
|---|
| Primer A | cacgtttagtgcaagtgataacg |
|---|
| Primer B | ggtcctgatcttcaaagaaaaca |
|---|
| Location (WS140) | I:5353762..5354225 [Wormbase - current] |
|---|
| Comments | Unidentified tail cell is possibly anal sphincter muscle. Cell in head is high-intensity GFP and is below the terminal bulb of the pharynx where it forms two low-intensity arms that go up into head and down to tail. Perhaps misplaced excretory cell |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, pharyngeal-intestinal valve, intestinal, rectal gland cells, body wall muscle, unidentified head, unidentified body, unidentified tail |
| Adult | pharynx, pharyngeal-intestinal valve, rectal gland cells, body wall muscle, excretory cell, unidentified head, unidentified body, unidentified tail |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
