Summary Information for BC10792 | |
| Gene(s) | Y55F3AL.1 |
|---|---|
| Locus | plx-1 |
| Strain | BC10792 |
| Transgene | sEx10792 |
| Mutagen | |
| Primer A | gaatcgcaatttttgctggt |
| Primer B | ggagaaatgtggggatttcat |
| Location (WS140) | IV:956600..959536 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, body wall muscle, seam cells, unidentified tail | |
| pharynx, intestinal, vulval muscle, body wall muscle, head neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |