Summary Information for BC10853 | |||
| Gene(s) | F54A5.3a | ||
|---|---|---|---|
| Locus | |||
| Strain | BC10853 | ||
| Transgene | sIs10623 | ||
| Mutagen | 1500 R x-rays | ||
| Primer A | aaaggataacctcccggaaat | ||
| Primer B | cgccgcaagttgattttt | ||
| Location (WS140) | I:973055..975932 [Wormbase - current] | ||
| Comments | Embryo incomplete. To be updated. | ||
| Expression Pattern | |||
| pharynx, intestinal, nerve ring, head neurons, tail neurons | |||
| pharynx, intestinal, vulval muscle, nerve ring, head neurons, tail neurons | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
