Summary Information for BC10853 | |||
Gene(s) | F54A5.3a | ||
---|---|---|---|
Locus | |||
Strain | BC10853 | ||
Transgene | sIs10623 | ||
Mutagen | 1500 R x-rays | ||
Primer A | aaaggataacctcccggaaat | ||
Primer B | cgccgcaagttgattttt | ||
Location (WS140) | I:973055..975932 [Wormbase - current] | ||
Comments | Embryo incomplete. To be updated. | ||
Expression Pattern | |||
pharynx, intestinal, nerve ring, head neurons, tail neurons | |||
pharynx, intestinal, vulval muscle, nerve ring, head neurons, tail neurons | |||
Embryo GFP | No | ||
Embryo Rec. | No | ||
Image(s) | |||
|