Summary Information for BC11033 | |
| Gene(s) | F23B12.5 |
|---|---|
| Locus | |
| Strain | BC11033 |
| Transgene | sEx11033 |
| Mutagen | |
| Primer A | agccatctcatcctttccct |
| Primer B | gggaacttcgagattacctgaata |
| Location (WS140) | V:14449863..14452759 [Wormbase - current] |
| Comments | GFP intensity is quite high, and it is difficult to distinguish some tissues. |
| Expression Pattern | |
| yes | |
| pharynx, intestinal, anal depressor muscle, body wall muscle, nerve ring, unidentified head, unidentified tail | |
| pharynx, intestinal, anal depressor muscle, vulva other, body wall muscle, nerve ring, ventral nerve cord, unidentified head, unidentified tail | |
| Embryo GFP | Yes |
| Embryo Rec. | No |