Summary Information for BC11109 | |
| Gene(s) | B0416.5a |
|---|---|
| Locus | |
| Strain | BC11109 |
| Transgene | sEx11109 |
| Mutagen | |
| Primer A | acgcacgattttcctacaaataa |
| Primer B | agcgccgattttgctttt |
| Location (WS140) | X:9270758..9273733 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal muscle, ventral nerve cord, head neurons, tail neurons | |
| pharynx, intestinal muscle, ventral nerve cord, head neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |