Summary Information for BC11135 | |
| Gene(s) | F15A2.6 |
|---|---|
| Locus | sad-1 |
| Strain | BC11135 |
| Transgene | sEx11135 |
| Mutagen | |
| Primer A | actttgaccgggtattatgaaaaa |
| Primer B | actttgcccgattgacga |
| Location (WS140) | X:13500478..13503301 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| nerve ring, ventral nerve cord, tail neurons, unidentified cells | |
| nerve ring, ventral nerve cord, tail neurons, unidentified cells | |
| Embryo GFP | No |
| Embryo Rec. | No |