Summary Information for BC11193 | |
| Gene(s) | C50D2.2 |
|---|---|
| Locus | |
| Strain | BC11193 |
| Transgene | sEx11193 |
| Mutagen | |
| Primer A | ttcacttctctggcttttcttttt |
| Primer B | gcagatttttgtttttgttcctg |
| Location (WS140) | II:107571..109208 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, ventral nerve cord, body neurons, tail neurons, unidentified head | |
| pharynx, intestinal, vulval muscle, ventral nerve cord, body neurons, tail neurons, unidentified head | |
| Embryo GFP | No |
| Embryo Rec. | No |