Summary Information for BC11193 | |
Gene(s) | C50D2.2 |
---|---|
Locus | |
Strain | BC11193 |
Transgene | sEx11193 |
Mutagen | |
Primer A | ttcacttctctggcttttcttttt |
Primer B | gcagatttttgtttttgttcctg |
Location (WS140) | II:107571..109208 [Wormbase - current] |
Comments | Embryo incomplete. To be updated. |
Expression Pattern | |
pharynx, intestinal, ventral nerve cord, body neurons, tail neurons, unidentified head | |
pharynx, intestinal, vulval muscle, ventral nerve cord, body neurons, tail neurons, unidentified head | |
Embryo GFP | No |
Embryo Rec. | No |