Summary Information for BC11205 | |
| Gene(s) | F27D9.5 |
|---|---|
| Locus | |
| Strain | BC11205 |
| Transgene | sIs10309 |
| Mutagen | 1500 R x-rays |
| Primer A | ccaatgcaatgaacgacca |
| Primer B | cggaggatggttcaacctaa |
| Location (WS140) | X:7660910..7661876 [Wormbase - current] |
| Comments | Body wall muscle is very bright and may be masking neural expression. |
| Expression Pattern | |
| body wall muscle, yes | |
| intestinal, body wall muscle, nerve ring | |
| intestinal, body wall muscle, nerve ring | |
| Embryo GFP | Yes |
| Embryo Rec. | No |