Summary Information for BC11238 | |
Gene(s) | H39E23.1a |
---|---|
Locus | par-1 |
Strain | BC11238 |
Transgene | sEx11238 |
Mutagen | |
Primer A | ctcttttctttctgctctcttgct |
Primer B | gacgccgagctcattgtt |
Location (WS140) | V:14143694..14146500 [Wormbase - current] |
Comments | Embryo incomplete. To be updated. |
Expression Pattern | |
body wall muscle, nerve ring, head neurons, body neurons, tail neurons | |
body wall muscle, nerve ring, head neurons, tail neurons | |
Embryo GFP | No |
Embryo Rec. | No |