Summary Information for BC11238 | |
| Gene(s) | H39E23.1a |
|---|---|
| Locus | par-1 |
| Strain | BC11238 |
| Transgene | sEx11238 |
| Mutagen | |
| Primer A | ctcttttctttctgctctcttgct |
| Primer B | gacgccgagctcattgtt |
| Location (WS140) | V:14143694..14146500 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| body wall muscle, nerve ring, head neurons, body neurons, tail neurons | |
| body wall muscle, nerve ring, head neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |