Summary Information for BC11304 | |
| Gene(s) | R09E12.3 |
|---|---|
| Locus | |
| Strain | BC11304 |
| Transgene | sEx11304 |
| Mutagen | |
| Primer A | ttttgtagatcacaacgatatggg |
| Primer B | tacggcgtccgtcatttt |
| Location (WS140) | V:772507..773435 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, body wall muscle, nerve ring, head neurons, tail neurons, unidentified body, unidentified tail | |
| pharynx, intestinal, head neurons, tail neurons, unidentified body, unidentified tail | |
| Embryo GFP | No |
| Embryo Rec. | No |