|
| Gene(s) | T21B10.2 |
|---|
| Locus | |
|---|
| Strain | BC11318 |
|---|
| Transgene | sEx11318 |
|---|
| Mutagen | |
|---|
| Primer A | tttgctctacgcaagttatttcag |
|---|
| Primer B | tcttggtgattgggatcctg |
|---|
| Location (WS140) | II:8930876..8932032 [Wormbase - current] |
|---|
| Comments | Unidentified cells in head, are possibly nuclei of the nerve ring. And what we thought were arcade cells!! may actually be the 2 amphid socket cells. |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, intestinal, rectal gland cells, anal depressor muscle, rectal epithelium, distal tip cell, developing vulva, developing spermatheca, body wall muscle, nerve ring, ventral nerve cord, head neurons, amphid socket cells, tail neurons, unidentified cells, unidentified head |
| Adult | pharynx, intestinal, rectal gland cells, anal depressor muscle, rectal epithelium, distal tip cell, uterine muscle, vulval muscle, spermatheca, body wall muscle, nerve ring, ventral nerve cord, head neurons, tail neurons, unidentified head |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
