|
| Gene(s) | D2089.4a |
|---|
| Locus | ptb-1 |
|---|
| Strain | BC11352 |
|---|
| Transgene | sIs10287 |
|---|
| Mutagen | 1500 R x-rays |
|---|
| Primer A | tgtcgaaaattgcctcagaa |
|---|
| Primer B | atgctcaccttggtgatgtg |
|---|
| Location (WS140) | II:10671601..10675585 [Wormbase - current] |
|---|
| Comments | The pharyngeal bulbs express but not the isthmus |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | pharynx, intestinal muscle, anal depressor muscle, developing vulva, developing uterus, developing spermatheca, head mesodermal cell, unidentified head, unidentified tail |
| Adult | pharynx, intestinal muscle, anal depressor muscle, uterus, vulval muscle, spermatheca, head mesodermal cell, unidentified head |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
| Video(s) |
|
|---|
|
