Summary Information for BC11686 | |
| Gene(s) | F42G9.9a |
|---|---|
| Locus | ptl-1 |
| Strain | BC11686 |
| Transgene | sEx11686 |
| Mutagen | |
| Primer A | ctcaaaacgagaaacttcattgg |
| Primer B | gaggggttgagatttttcctg |
| Location (WS140) | III:762360..765207 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, head neurons, tail neurons, unidentified cells | |
| pharynx, intestinal, head neurons, tail neurons, unidentified cells | |
| Embryo GFP | No |
| Embryo Rec. | No |