Summary Information for BC12076 | |
| Gene(s) | C34F11.9a |
|---|---|
| Locus | |
| Strain | BC12076 |
| Transgene | sEx12076 |
| Mutagen | |
| Primer A | atgccacccaagcaacttac |
| Primer B | actcggcgatttttatggact |
| Location (WS140) | II:5225336..5228192 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, ventral nerve cord, head neurons, tail neurons | |
| pharynx, intestinal, vulval muscle, ventral nerve cord, head neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |