Summary Information for BC12098 | |
| Gene(s) | C05B5.7 |
|---|---|
| Locus | rgs-1 |
| Strain | BC12098 |
| Transgene | sEx12098 |
| Mutagen | |
| Primer A | atagacgttttcttctccgttttt |
| Primer B | atatatccgatgggctggc |
| Location (WS140) | III:10016414..10019355 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| nerve ring, ventral nerve cord, head neurons, tail neurons | |
| nerve ring, head neurons, tail neurons, unidentified cells | |
| Embryo GFP | No |
| Embryo Rec. | No |