Summary Information for BC12162 | ||||||
| Gene(s) | H13N06.6 | |||||
|---|---|---|---|---|---|---|
| Locus | tbh-1 | |||||
| Strain | BC12162 | |||||
| Transgene | sEx12162 | |||||
| Mutagen | ||||||
| Primer A | tcaccctctccttcttgatgtt | |||||
| Primer B | caacggcacttctgatttttc | |||||
| Location (WS140) | X:15503286..15506025 [Wormbase - current] | |||||
| Comments | Embryo incomplete. To be updated. | |||||
| Expression Pattern | ||||||
| intestinal, rectal gland cells, head neurons | ||||||
| intestinal, rectal gland cells, spermatheca, gonad sheath cells, head neurons | ||||||
| Embryo GFP | No | |||||
| Embryo Rec. | No | |||||
| Image(s) | ||||||
| ||||||
| Video(s) | ||||||
| ||||||
