Summary Information for BC12162 | ||||||
Gene(s) | H13N06.6 | |||||
---|---|---|---|---|---|---|
Locus | tbh-1 | |||||
Strain | BC12162 | |||||
Transgene | sEx12162 | |||||
Mutagen | ||||||
Primer A | tcaccctctccttcttgatgtt | |||||
Primer B | caacggcacttctgatttttc | |||||
Location (WS140) | X:15503286..15506025 [Wormbase - current] | |||||
Comments | Embryo incomplete. To be updated. | |||||
Expression Pattern | ||||||
intestinal, rectal gland cells, head neurons | ||||||
intestinal, rectal gland cells, spermatheca, gonad sheath cells, head neurons | ||||||
Embryo GFP | No | |||||
Embryo Rec. | No | |||||
Image(s) | ||||||
| ||||||
Video(s) | ||||||
|