Summary Information for BC12276 | |
| Gene(s) | C03C10.1 |
|---|---|
| Locus | |
| Strain | BC12276 |
| Transgene | sIs10439 |
| Mutagen | 1500 R x-rays |
| Primer A | tgaagttttcgtgaatcctcct |
| Primer B | attgtttgctctgatcgtgct |
| Location (WS140) | III:4086459..4089385 [Wormbase - current] |
| Comments | Some punctate pattern in head and tail that may be neural. |
| Expression Pattern | |
| yes | |
| pharynx, intestinal, anal depressor muscle, body wall muscle, excretory cell, unidentified head, unidentified tail | |
| pharynx, intestinal, anal depressor muscle, vulval muscle, spermatheca, gonad sheath cells, body wall muscle, excretory cell, unidentified head, unidentified tail | |
| Embryo GFP | Yes |
| Embryo Rec. | No |