Summary Information for BC12501 | |
| Gene(s) | F26F4.3 |
|---|---|
| Locus | rom-1 |
| Strain | BC12501 |
| Transgene | sEx12501 |
| Mutagen | |
| Primer A | tgcaatcacatccgatagtttc |
| Primer B | aaagatgttgtggagaaggagaac |
| Location (WS140) | III:4904334..4907192 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, pharyngeal-intestinal valve, intestinal, rectal gland cells, hypodermis, head neurons | |
| pharynx, pharyngeal-intestinal valve, intestinal, rectal gland cells, vulval muscle, head neurons, unidentified cells | |
| Embryo GFP | No |
| Embryo Rec. | No |