Summary Information for BC12773 | |
| Gene(s) | F09C3.1 |
|---|---|
| Locus | pes-7 |
| Strain | BC12773 |
| Transgene | sEx12773 |
| Mutagen | |
| Primer A | gtttttgggaaatgagccttc |
| Primer B | gctggttcggtttcgatagtt |
| Location (WS140) | I:14268645..14271448 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| hypodermis, nerve ring, ventral nerve cord, dorsal nerve cord, lateral nerve cords/commissures, head neurons, body neurons, tail neurons | |
| hypodermis, nerve ring, ventral nerve cord, dorsal nerve cord, lateral nerve cords/commissures, head neurons, body neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |