Summary Information for BC12911 | |
| Gene(s) | T26A5.9 |
|---|---|
| Locus | dlc-1 |
| Strain | BC12911 |
| Transgene | sIs10571 |
| Mutagen | 1500 R x-rays |
| Primer A | cactttgtgatcgtcggattta |
| Primer B | attttgaacggatttggctg |
| Location (WS140) | III:6463700..6466574 [Wormbase - current] |
| Comments | Mosaic population. Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, body wall muscle, head neurons, tail neurons | |
| pharynx, head neurons, body neurons, unidentified tail | |
| Embryo GFP | No |
| Embryo Rec. | No |