Summary Information for BC13313 | |||
Gene(s) | F25H8.3 | ||
---|---|---|---|
Locus | gon-1 | ||
Strain | BC13313 | ||
Transgene | sEx13313 | ||
Mutagen | |||
Primer A | gtcagaatgaacaaagggggt | ||
Primer B | cggataccaacagctccg | ||
Location (WS140) | IV:9945743..9948612 [Wormbase - current] | ||
Comments | Embryo incomplete. To be updated. | ||
Expression Pattern | |||
anal sphincter, body wall muscle, head neurons, tail neurons | |||
anal sphincter, vulval muscle, spermatheca, body wall muscle, head mesodermal cell, head neurons, tail neurons | |||
Embryo GFP | No | ||
Embryo Rec. | No | ||
Image(s) | |||
|