Summary Information for BC13313 | |||
| Gene(s) | F25H8.3 | ||
|---|---|---|---|
| Locus | gon-1 | ||
| Strain | BC13313 | ||
| Transgene | sEx13313 | ||
| Mutagen | |||
| Primer A | gtcagaatgaacaaagggggt | ||
| Primer B | cggataccaacagctccg | ||
| Location (WS140) | IV:9945743..9948612 [Wormbase - current] | ||
| Comments | Embryo incomplete. To be updated. | ||
| Expression Pattern | |||
| anal sphincter, body wall muscle, head neurons, tail neurons | |||
| anal sphincter, vulval muscle, spermatheca, body wall muscle, head mesodermal cell, head neurons, tail neurons | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
