Summary Information for BC13567 | |
| Gene(s) | C32D5.9 |
|---|---|
| Locus | lgg-1 |
| Strain | BC13567 |
| Transgene | sEx13567 |
| Mutagen | |
| Primer A | gcactttcaaggcgacagta |
| Primer B | gcccacttgattttgattcg |
| Location (WS140) | II:6347623..6349537 [Wormbase - current] |
| Comments | Embryo incomplete. To be updated. |
| Expression Pattern | |
| pharynx, intestinal, body wall muscle, seam cells, nerve ring, ventral nerve cord, body neurons, tail neurons | |
| pharynx, intestinal, body wall muscle, seam cells, nerve ring, ventral nerve cord, body neurons, tail neurons | |
| Embryo GFP | No |
| Embryo Rec. | No |