|
| Gene(s) | Y60A3A.9 |
|---|
| Locus | |
|---|
| Strain | BC14376 |
|---|
| Transgene | sEx14376 |
|---|
| Mutagen | |
|---|
| Primer A | agcacagaacgaatgttgatt |
|---|
| Primer B | ggggattttgagggaaaaagt |
|---|
| Location (WS140) | V:19947104..19949481 [Wormbase - current] |
|---|
| Comments | Low intensity GFP in head . Expression in gonad sheath cells is exclusively in pair 5, next to the spermatheca. |
|---|
| Expression Pattern |
|
|---|
| Embryo | yes |
| Larval | gonad sheath cells, head neurons, amphids, body neurons, pvt interneuron |
| Adult | gonad sheath cells, head neurons, amphids, body neurons, pvt interneuron, tail neurons |
| Embryo GFP | Yes |
|---|
| Embryo Rec. | No |
|---|
| Image(s) |
|
|---|
|
| Video(s) |
|
|---|
|
