Summary Information for BC14533 | |||
Gene(s) | Y57G11C.12 | ||
---|---|---|---|
Locus | |||
Strain | BC14533 | ||
Transgene | sEx14533 | ||
Mutagen | |||
Primer A | ccttcaagaaatacagtaccccac | ||
Primer B | cgaaagagtatctcctttggtga | ||
Location (WS140) | IV:14796929..14799872 [Wormbase - current] | ||
Comments | Unidentified tissue in the body is part of the reproductive system | ||
Expression Pattern | |||
yes | |||
pharynx, developing uterus, body wall muscle, unidentified body | |||
pharynx, uterus, body wall muscle | |||
Embryo GFP | Yes | ||
Embryo Rec. | No | ||
Image(s) | |||
|