Summary Information for BC14533 | |||
| Gene(s) | Y57G11C.12 | ||
|---|---|---|---|
| Locus | |||
| Strain | BC14533 | ||
| Transgene | sEx14533 | ||
| Mutagen | |||
| Primer A | ccttcaagaaatacagtaccccac | ||
| Primer B | cgaaagagtatctcctttggtga | ||
| Location (WS140) | IV:14796929..14799872 [Wormbase - current] | ||
| Comments | Unidentified tissue in the body is part of the reproductive system | ||
| Expression Pattern | |||
| yes | |||
| pharynx, developing uterus, body wall muscle, unidentified body | |||
| pharynx, uterus, body wall muscle | |||
| Embryo GFP | Yes | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
