|
| Gene(s) | W08G11.4 |
|---|
| Locus | |
|---|
| Strain | BC14613 |
|---|
| Transgene | sEx14613 |
|---|
| Mutagen | |
|---|
| Primer A | gcgtctcgtcttgtttctacagt |
|---|
| Primer B | ccgcttccgtggattttt |
|---|
| Location (WS140) | V:16357401..16360248 [Wormbase - current] |
|---|
| Comments | Mosaic population. Embryo incomplete. To be updated. |
|---|
| Expression Pattern |
|
|---|
| Larval | pharynx, intestinal, distal tip cell, body wall muscle, excretory cell, nerve ring, ventral nerve cord, head neurons, body neurons, tail neurons, phasmids, unidentified head, unidentified tail |
| Adult | pharynx, intestinal, body wall muscle, excretory cell, nerve ring, ventral nerve cord, head neurons, body neurons, tail neurons, phasmids, unidentified head, unidentified tail |
| Embryo GFP | No |
|---|
| Embryo Rec. | No |
|---|
| Video(s) |
|
|---|
|
