Summary Information for BC14673 | ||||||
| Gene(s) | T01B11.4 | |||||
|---|---|---|---|---|---|---|
| Locus | ||||||
| Strain | BC14673 | |||||
| Transgene | sIs13886 | |||||
| Mutagen | 1500 R x-rays | |||||
| Primer A | tttttgcggctacagtgttct | |||||
| Primer B | cttacctccagacatgcttgc | |||||
| Location (WS140) | IV:8460245..8463162 [Wormbase - current] | |||||
| Comments | Embryo incomplete. To be updated. | |||||
| Expression Pattern | ||||||
| head neurons, amphids, body neurons, tail neurons, phasmids | ||||||
| head neurons, amphids, body neurons, tail neurons, phasmids | ||||||
| Embryo GFP | No | |||||
| Embryo Rec. | No | |||||
| Image(s) | ||||||
| ||||||
| Video(s) | ||||||
| ||||||
