Summary Information for BC14673 | ||||||
Gene(s) | T01B11.4 | |||||
---|---|---|---|---|---|---|
Locus | ||||||
Strain | BC14673 | |||||
Transgene | sIs13886 | |||||
Mutagen | 1500 R x-rays | |||||
Primer A | tttttgcggctacagtgttct | |||||
Primer B | cttacctccagacatgcttgc | |||||
Location (WS140) | IV:8460245..8463162 [Wormbase - current] | |||||
Comments | Embryo incomplete. To be updated. | |||||
Expression Pattern | ||||||
head neurons, amphids, body neurons, tail neurons, phasmids | ||||||
head neurons, amphids, body neurons, tail neurons, phasmids | ||||||
Embryo GFP | No | |||||
Embryo Rec. | No | |||||
Image(s) | ||||||
| ||||||
Video(s) | ||||||
|