Summary Information for BC14674 | |||
| Gene(s) | ZC518.3a | ||
|---|---|---|---|
| Locus | ccr-4 | ||
| Strain | BC14674 | ||
| Transgene | sEx14674 | ||
| Mutagen | |||
| Primer A | tttttcagtcaacatacggtcg | ||
| Primer B | accatttaaaataccggtcatcc | ||
| Location (WS140) | IV:12359175..12362035 [Wormbase - current] | ||
| Comments | Analysis notes were lost. Have extroplated from the images. Adult and Embryo incomplete. To be updated. | ||
| Expression Pattern | |||
| pharynx, hypodermis, seam cells | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
