Summary Information for BC14674 | |||
Gene(s) | ZC518.3a | ||
---|---|---|---|
Locus | ccr-4 | ||
Strain | BC14674 | ||
Transgene | sEx14674 | ||
Mutagen | |||
Primer A | tttttcagtcaacatacggtcg | ||
Primer B | accatttaaaataccggtcatcc | ||
Location (WS140) | IV:12359175..12362035 [Wormbase - current] | ||
Comments | Analysis notes were lost. Have extroplated from the images. Adult and Embryo incomplete. To be updated. | ||
Expression Pattern | |||
pharynx, hypodermis, seam cells | |||
Embryo GFP | No | ||
Embryo Rec. | No | ||
Image(s) | |||
|