Summary Information for BC15005 | ||||||
| Gene(s) | Y111B2A.8 | |||||
|---|---|---|---|---|---|---|
| Locus | ||||||
| Strain | BC15005 | |||||
| Transgene | sEx15005 | |||||
| Mutagen | ||||||
| Primer A | aacatcgaaatttttggtttgg | |||||
| Primer B | ttgtgagccttgatgaataaagaa | |||||
| Location (WS140) | III:12544674..12547058 [Wormbase - current] | |||||
| Comments | Neural expression looks like the inner or outer labial sensilla. Larvae have more GFP than adults. Embryo incomplete. To be updated. | |||||
| Expression Pattern | ||||||
| head neurons, labial sensilla | ||||||
| head neurons, labial sensilla | ||||||
| Embryo GFP | No | |||||
| Embryo Rec. | No | |||||
| Video(s) | ||||||
| ||||||
