Summary Information for BC15721 | |||
Gene(s) | F09G2.4 | ||
---|---|---|---|
Locus | |||
Strain | BC15721 | ||
Transgene | sEx15721 | ||
Mutagen | |||
Primer A | agtgtattttcataaacggtcg | ||
Primer B | gtgtcttttaggttttcccgc | ||
Location (WS140) | V:0..0 [Wormbase - current] | ||
Comments | Embryo incomplete. To be updated. | ||
Expression Pattern | |||
pharynx, anal depressor muscle, body wall muscle, hypodermis | |||
pharynx, anal depressor muscle, body wall muscle, hypodermis | |||
Embryo GFP | No | ||
Embryo Rec. | No | ||
Image(s) | |||
|