Summary Information for BC15721 | |||
| Gene(s) | F09G2.4 | ||
|---|---|---|---|
| Locus | |||
| Strain | BC15721 | ||
| Transgene | sEx15721 | ||
| Mutagen | |||
| Primer A | agtgtattttcataaacggtcg | ||
| Primer B | gtgtcttttaggttttcccgc | ||
| Location (WS140) | V:0..0 [Wormbase - current] | ||
| Comments | Embryo incomplete. To be updated. | ||
| Expression Pattern | |||
| pharynx, anal depressor muscle, body wall muscle, hypodermis | |||
| pharynx, anal depressor muscle, body wall muscle, hypodermis | |||
| Embryo GFP | No | ||
| Embryo Rec. | No | ||
| Image(s) | |||
| |||
